ID: 962210283_962210287

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 962210283 962210287
Species Human (GRCh38) Human (GRCh38)
Location 3:133471881-133471903 3:133471898-133471920
Sequence CCAAATGATGGATGGGGTTTCAG TTTCAGCAGCAGAGGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102} {0: 1, 1: 0, 2: 5, 3: 47, 4: 507}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!