ID: 962215526_962215528

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 962215526 962215528
Species Human (GRCh38) Human (GRCh38)
Location 3:133517661-133517683 3:133517679-133517701
Sequence CCCTCTGCTGTGTAACTCTGCAG TGCAGTTCCTCCACAAATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!