ID: 962234295_962234301

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 962234295 962234301
Species Human (GRCh38) Human (GRCh38)
Location 3:133694249-133694271 3:133694281-133694303
Sequence CCTGTGAGGACATGAAGAATTTC TGTCAACTGTGTGCAGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 195} {0: 1, 1: 0, 2: 1, 3: 21, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!