ID: 962240684_962240691

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 962240684 962240691
Species Human (GRCh38) Human (GRCh38)
Location 3:133748383-133748405 3:133748401-133748423
Sequence CCCTTCCACCTCTGGCCTCTCTC CTCTCCCCCAGGGCTGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 108, 4: 717} {0: 1, 1: 0, 2: 6, 3: 49, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!