ID: 962241769_962241780

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 962241769 962241780
Species Human (GRCh38) Human (GRCh38)
Location 3:133756244-133756266 3:133756282-133756304
Sequence CCCTGCAGGAGCCCTGCTGATGT GTGTCTGAAGGATGGTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 166} {0: 1, 1: 0, 2: 4, 3: 26, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!