ID: 962249040_962249050

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 962249040 962249050
Species Human (GRCh38) Human (GRCh38)
Location 3:133823716-133823738 3:133823745-133823767
Sequence CCTGGAGGGGCCACTCAGGGATG ACTGGTGTGGTGTGGGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 229} {0: 1, 1: 1, 2: 6, 3: 119, 4: 1188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!