ID: 962249380_962249386

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 962249380 962249386
Species Human (GRCh38) Human (GRCh38)
Location 3:133826095-133826117 3:133826117-133826139
Sequence CCACACCCCAGGAAGGGAGGGGC CGGAAACCGCACGTGCCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 470} {0: 1, 1: 0, 2: 0, 3: 0, 4: 6}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!