ID: 962251631_962251639

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 962251631 962251639
Species Human (GRCh38) Human (GRCh38)
Location 3:133839522-133839544 3:133839574-133839596
Sequence CCGTCTTGTTGCCCACCAGCATG GACGTCGTCGATCCACTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 193} {0: 1, 1: 0, 2: 0, 3: 0, 4: 6}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!