ID: 962264027_962264035

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 962264027 962264035
Species Human (GRCh38) Human (GRCh38)
Location 3:133933158-133933180 3:133933172-133933194
Sequence CCATGACCCATGCCCAGCTGTTC CAGCTGTTCCAGAGGACATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 254} {0: 1, 1: 0, 2: 2, 3: 21, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!