ID: 962264810_962264814

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 962264810 962264814
Species Human (GRCh38) Human (GRCh38)
Location 3:133937316-133937338 3:133937329-133937351
Sequence CCCTGCTTCCTCTGTGTTTATAA GTGTTTATAATGCAGGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 409} {0: 1, 1: 1, 2: 2, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!