ID: 962278698_962278701

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 962278698 962278701
Species Human (GRCh38) Human (GRCh38)
Location 3:134034334-134034356 3:134034347-134034369
Sequence CCTTCAACTCAGCTGTGGGCTCT TGTGGGCTCTTCAAGGGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 18, 4: 207} {0: 1, 1: 0, 2: 6, 3: 38, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!