ID: 962287915_962287919

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 962287915 962287919
Species Human (GRCh38) Human (GRCh38)
Location 3:134103845-134103867 3:134103880-134103902
Sequence CCCAGCTCCATCTTTTCAAAGTG CTCTCCCTAGACTCCCCTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 277} {0: 1, 1: 0, 2: 2, 3: 24, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!