ID: 962290977_962290979

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 962290977 962290979
Species Human (GRCh38) Human (GRCh38)
Location 3:134136107-134136129 3:134136135-134136157
Sequence CCTGCAGTGGGTCCAGGTCTCTT TCAGCTTCTCCTACGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 150} {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!