ID: 962313414_962313419

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 962313414 962313419
Species Human (GRCh38) Human (GRCh38)
Location 3:134342052-134342074 3:134342092-134342114
Sequence CCAATGACTGATGTCTTTATAAG CAGAGGAGACACAGGGAAGAAGG
Strand - +
Off-target summary No data {0: 3, 1: 2, 2: 15, 3: 101, 4: 938}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!