ID: 962335602_962335607

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 962335602 962335607
Species Human (GRCh38) Human (GRCh38)
Location 3:134527547-134527569 3:134527588-134527610
Sequence CCTGCTGGTGGGGCAAGAAAAGC CACATGCCAGCAAAGCCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 168} {0: 1, 1: 4, 2: 7, 3: 37, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!