ID: 962349132_962349139

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 962349132 962349139
Species Human (GRCh38) Human (GRCh38)
Location 3:134644118-134644140 3:134644135-134644157
Sequence CCCGGCCGAGCCTCCTGCTTCTT CTTCTTAATGAGAAGAACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 448} {0: 1, 1: 0, 2: 0, 3: 19, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!