ID: 962351081_962351087

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 962351081 962351087
Species Human (GRCh38) Human (GRCh38)
Location 3:134656188-134656210 3:134656214-134656236
Sequence CCAGGAAGGCTACATCCCCAAAC GTCCTCAGGGATGAATGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 115} {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!