ID: 962373749_962373755

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 962373749 962373755
Species Human (GRCh38) Human (GRCh38)
Location 3:134842447-134842469 3:134842478-134842500
Sequence CCATCCTGGGCCTGTGCCATTCC CAGTCAGAAGATCCTTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 356} {0: 1, 1: 0, 2: 0, 3: 15, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!