ID: 962373752_962373755

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 962373752 962373755
Species Human (GRCh38) Human (GRCh38)
Location 3:134842463-134842485 3:134842478-134842500
Sequence CCATTCCAATGCCTGCAGTCAGA CAGTCAGAAGATCCTTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 227} {0: 1, 1: 0, 2: 0, 3: 15, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!