ID: 962377472_962377473

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 962377472 962377473
Species Human (GRCh38) Human (GRCh38)
Location 3:134870462-134870484 3:134870478-134870500
Sequence CCATCAACTGGGGAATATTCAGA ATTCAGAAGCCCACTTAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 164} {0: 1, 1: 0, 2: 1, 3: 22, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!