ID: 962379074_962379079

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 962379074 962379079
Species Human (GRCh38) Human (GRCh38)
Location 3:134882523-134882545 3:134882554-134882576
Sequence CCCAATTATGAAGCATCAGCGTC CATAACACTGTTTAACCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 0, 2: 1, 3: 3, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!