ID: 962384828_962384835

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 962384828 962384835
Species Human (GRCh38) Human (GRCh38)
Location 3:134924114-134924136 3:134924162-134924184
Sequence CCTTCCACCTTATGCAGAAATTA GAAAAAAATCTTTGTGACCTTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 279, 3: 9367, 4: 10890} {0: 1, 1: 30, 2: 152, 3: 419, 4: 1400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!