ID: 962405419_962405422

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 962405419 962405422
Species Human (GRCh38) Human (GRCh38)
Location 3:135095841-135095863 3:135095891-135095913
Sequence CCTGTTATAGGGGGCTTATATCT TTCCCAAGGCTCTCCCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52} {0: 1, 1: 0, 2: 0, 3: 24, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!