ID: 962422443_962422449

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 962422443 962422449
Species Human (GRCh38) Human (GRCh38)
Location 3:135240405-135240427 3:135240423-135240445
Sequence CCAATTTAGAAACTTCCAGTGTG GTGTGGGATTGGAGGCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 211} {0: 1, 1: 0, 2: 0, 3: 29, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!