ID: 962477414_962477416

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 962477414 962477416
Species Human (GRCh38) Human (GRCh38)
Location 3:135767552-135767574 3:135767571-135767593
Sequence CCTGCTTTGGCCAATCAGGGTTC GTTCAGCTCTATTGACAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!