ID: 962505769_962505778

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 962505769 962505778
Species Human (GRCh38) Human (GRCh38)
Location 3:136045265-136045287 3:136045308-136045330
Sequence CCTTGGCTCACCCAGCACAGCTG AGAGAACTAAGCTACAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 358} {0: 1, 1: 0, 2: 5, 3: 33, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!