ID: 962514285_962514292

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 962514285 962514292
Species Human (GRCh38) Human (GRCh38)
Location 3:136135513-136135535 3:136135566-136135588
Sequence CCAGACTCAGGTATCAGAAAGGG GCTTAGGAGCCAGACAGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144} {0: 1, 1: 1, 2: 16, 3: 159, 4: 739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!