ID: 962520710_962520725

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 962520710 962520725
Species Human (GRCh38) Human (GRCh38)
Location 3:136195762-136195784 3:136195803-136195825
Sequence CCCGTGGGTTGCAGCCCGCAGTT GGCGGGAGTCCTCAACCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79} {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!