ID: 962562788_962562794

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 962562788 962562794
Species Human (GRCh38) Human (GRCh38)
Location 3:136624770-136624792 3:136624796-136624818
Sequence CCATAGCCAATTTCAAATGACCA TGGCATAACCAAAGTGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 296} {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!