ID: 962568387_962568391

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 962568387 962568391
Species Human (GRCh38) Human (GRCh38)
Location 3:136687660-136687682 3:136687697-136687719
Sequence CCCCTTTGGCAAGAGACTGGGAA TTGTCTTTCTAGAAAAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 169} {0: 1, 1: 0, 2: 4, 3: 54, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!