|
Left Crispr |
Right Crispr |
| Crispr ID |
962598258 |
962598264 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:136969291-136969313
|
3:136969342-136969364
|
| Sequence |
CCAGCCTCGTTGCCGCCTTGCAG |
CAGCGCGATTCCGTGGGCGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 315, 1: 1152, 2: 1845, 3: 1595, 4: 741} |
{0: 16, 1: 450, 2: 786, 3: 859, 4: 831} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|