|
Left Crispr |
Right Crispr |
| Crispr ID |
962602354 |
962602359 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:137002837-137002859
|
3:137002852-137002874
|
| Sequence |
CCTTGCCCATGCCTATGTCCTGA |
TGTCCTGAATGGTATTGCCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 10218, 1: 5001, 2: 1235, 3: 356, 4: 470} |
{0: 8513, 1: 11095, 2: 4149, 3: 2051, 4: 1564} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|