|
Left Crispr |
Right Crispr |
| Crispr ID |
962602358 |
962602361 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:137002848-137002870
|
3:137002864-137002886
|
| Sequence |
CCTATGTCCTGAATGGTATTGCC |
TATTGCCTAGGTTTTCTTCTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8681, 1: 11646, 2: 4690, 3: 2246, 4: 1617} |
{0: 8506, 1: 11179, 2: 4881, 3: 2884, 4: 2254} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|