ID: 962602360_962602363

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 962602360 962602363
Species Human (GRCh38) Human (GRCh38)
Location 3:137002855-137002877 3:137002874-137002896
Sequence CCTGAATGGTATTGCCTAGGTTT GTTTTCTTCTAGGACTTTTATGG
Strand - +
Off-target summary {0: 8733, 1: 11767, 2: 5172, 3: 2689, 4: 1745} {0: 17, 1: 979, 2: 15216, 3: 6154, 4: 3042}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!