ID: 962626849_962626854

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 962626849 962626854
Species Human (GRCh38) Human (GRCh38)
Location 3:137234206-137234228 3:137234235-137234257
Sequence CCCAGTTAAGCCTTGATATGACT CCAGCCAACACCTTAACTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 24, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!