|
Left Crispr |
Right Crispr |
| Crispr ID |
962712809 |
962712816 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:138101846-138101868
|
3:138101865-138101887
|
| Sequence |
CCCGCTGCAGGGCGCCCTCCAGC |
CAGCTCGGACAGCTTGGCGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 18, 2: 20, 3: 69, 4: 396} |
{0: 7, 1: 13, 2: 13, 3: 13, 4: 72} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|