ID: 962714530_962714539

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 962714530 962714539
Species Human (GRCh38) Human (GRCh38)
Location 3:138115278-138115300 3:138115311-138115333
Sequence CCGCTCCCGGGACGAATTCCTGG CCGCGCGGCCCGCTCACCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122} {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!