ID: 962714533_962714544

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 962714533 962714544
Species Human (GRCh38) Human (GRCh38)
Location 3:138115284-138115306 3:138115326-138115348
Sequence CCGGGACGAATTCCTGGCATAGT ACCGTGGGGTCTCCTGGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 88} {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!