ID: 962739598_962739603

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 962739598 962739603
Species Human (GRCh38) Human (GRCh38)
Location 3:138353433-138353455 3:138353470-138353492
Sequence CCTGGACCCTTCTAGAGACACAG GAGTCAGTCCACTGCATTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172} {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!