ID: 962748752_962748758

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 962748752 962748758
Species Human (GRCh38) Human (GRCh38)
Location 3:138417429-138417451 3:138417461-138417483
Sequence CCTTGGGCAAGTTATTCCAATTC GGGTTCCCTCTTCTGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 22, 3: 202, 4: 1123} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!