ID: 962754449_962754455

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 962754449 962754455
Species Human (GRCh38) Human (GRCh38)
Location 3:138457333-138457355 3:138457354-138457376
Sequence CCTCAGGGCCACTCTGTGTGGCT CTGTGTGAGTAGGGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 296} {0: 1, 1: 0, 2: 6, 3: 55, 4: 498}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!