ID: 962825372_962825375

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 962825372 962825375
Species Human (GRCh38) Human (GRCh38)
Location 3:139095992-139096014 3:139096016-139096038
Sequence CCTGCAGTGGCTCCTCTGGATTT CTGGTCAGCCAGATGTGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 195} {0: 1, 1: 1, 2: 0, 3: 22, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!