ID: 962843101_962843112

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 962843101 962843112
Species Human (GRCh38) Human (GRCh38)
Location 3:139252873-139252895 3:139252896-139252918
Sequence CCCCTCTTCTGGGGACAGCCCCG GCAGGGTCCATGGGAACATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 144} {0: 1, 1: 0, 2: 3, 3: 20, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!