ID: 962850563_962850572

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 962850563 962850572
Species Human (GRCh38) Human (GRCh38)
Location 3:139305694-139305716 3:139305731-139305753
Sequence CCAAAGATAGCCATGCCCTATGT ATGCCTTTCTTGCAGGGTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145} {0: 1, 1: 0, 2: 0, 3: 20, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!