ID: 962851805_962851807

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 962851805 962851807
Species Human (GRCh38) Human (GRCh38)
Location 3:139313700-139313722 3:139313714-139313736
Sequence CCTGTTTCAGTCTTGGGAGAAAG GGGAGAAAGAAAGAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 217, 4: 4573} {0: 1, 1: 8, 2: 88, 3: 843, 4: 4800}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!