|
Left Crispr |
Right Crispr |
| Crispr ID |
962851805 |
962851809 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:139313700-139313722
|
3:139313719-139313741
|
| Sequence |
CCTGTTTCAGTCTTGGGAGAAAG |
AAAGAAAGAAGAGGAAGGCAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 12, 3: 217, 4: 4573} |
{0: 1, 1: 4, 2: 77, 3: 764, 4: 4863} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|