|
Left Crispr |
Right Crispr |
| Crispr ID |
962882466 |
962882471 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:139591300-139591322
|
3:139591351-139591373
|
| Sequence |
CCTGGCTCAGAGGGTCCTACGCC |
CAGTCTGAGATCAAACTGCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 522, 1: 1421, 2: 1460, 3: 1026, 4: 831} |
{0: 3663, 1: 1439, 2: 732, 3: 491, 4: 588} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|