|
Left Crispr |
Right Crispr |
Crispr ID |
962882469 |
962882474 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:139591321-139591343
|
3:139591367-139591389
|
Sequence |
CCCACGGAATCGCGCTGATTGCT |
TGCAAGGCGGCAACGAGGCTCGG |
Strand |
- |
+ |
Off-target summary |
{0: 18, 1: 502, 2: 1053, 3: 1038, 4: 855} |
{0: 317, 1: 1173, 2: 1908, 3: 1654, 4: 702} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|