|
Left Crispr |
Right Crispr |
| Crispr ID |
962882470 |
962882473 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:139591322-139591344
|
3:139591362-139591384
|
| Sequence |
CCACGGAATCGCGCTGATTGCTA |
CAAACTGCAAGGCGGCAACGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 494, 2: 1064, 3: 1054, 4: 865} |
{0: 317, 1: 1166, 2: 1768, 3: 1553, 4: 836} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|