ID: 962883148_962883153

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 962883148 962883153
Species Human (GRCh38) Human (GRCh38)
Location 3:139598259-139598281 3:139598276-139598298
Sequence CCATTGAGAGGTGAAGTCTGTGT CTGTGTTCCTCCTAGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 20, 3: 60, 4: 335} {0: 1, 1: 0, 2: 1, 3: 16, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!